ID: 1095716815_1095716819

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1095716815 1095716819
Species Human (GRCh38) Human (GRCh38)
Location 12:45355414-45355436 12:45355436-45355458
Sequence CCTGACCAGCTCTTTAAATACAG GCAGGATTTTTTTTATTATTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 132} {0: 1, 1: 1, 2: 11, 3: 97, 4: 802}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!