ID: 1095721519_1095721528

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1095721519 1095721528
Species Human (GRCh38) Human (GRCh38)
Location 12:45406322-45406344 12:45406368-45406390
Sequence CCCAGCTCCACCTTAGTGTTTTG TTTATTCTGTTCTTAATAAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 139} {0: 1, 1: 0, 2: 4, 3: 61, 4: 745}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!