ID: 1095954797_1095954809

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1095954797 1095954809
Species Human (GRCh38) Human (GRCh38)
Location 12:47799825-47799847 12:47799874-47799896
Sequence CCAGAGAGGCTGAGACACTGGGA CTGGAGAAGGGGAAGTGGGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 50, 4: 620} {0: 1, 1: 0, 2: 10, 3: 87, 4: 773}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!