ID: 1095961075_1095961087

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1095961075 1095961087
Species Human (GRCh38) Human (GRCh38)
Location 12:47834761-47834783 12:47834802-47834824
Sequence CCACTCCTCTACCACCTCCAGTC GAGGCAGGAGCCTCTTGGGGTGG
Strand - +
Off-target summary {0: 2, 1: 1, 2: 0, 3: 59, 4: 676} {0: 1, 1: 0, 2: 3, 3: 38, 4: 344}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!