ID: 1095961082_1095961087

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1095961082 1095961087
Species Human (GRCh38) Human (GRCh38)
Location 12:47834787-47834809 12:47834802-47834824
Sequence CCTGTGAACACAGCAGAGGCAGG GAGGCAGGAGCCTCTTGGGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 70, 4: 469} {0: 1, 1: 0, 2: 3, 3: 38, 4: 344}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!