ID: 1095982172_1095982186

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1095982172 1095982186
Species Human (GRCh38) Human (GRCh38)
Location 12:47979938-47979960 12:47979989-47980011
Sequence CCCGCCATGGGAGCCTCTGGGGC GTGTCAGAGGCCTCACTCACCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 39, 4: 321} {0: 1, 1: 0, 2: 1, 3: 19, 4: 122}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!