ID: 1095982716_1095982729

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1095982716 1095982729
Species Human (GRCh38) Human (GRCh38)
Location 12:47982181-47982203 12:47982215-47982237
Sequence CCGCCTCAGCCAGGCACCCCAGG TTGCTCAGTCCCACCCAGGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 59, 4: 543} {0: 1, 1: 2, 2: 25, 3: 121, 4: 596}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!