ID: 1095986053_1095986057

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1095986053 1095986057
Species Human (GRCh38) Human (GRCh38)
Location 12:48000559-48000581 12:48000584-48000606
Sequence CCACCAGCCCAGGAGCAGAGAAG TTCTTTCTTCTGCCTTCCTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 52, 4: 428} {0: 1, 1: 1, 2: 14, 3: 109, 4: 816}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!