|
Left Crispr |
Right Crispr |
Crispr ID |
1096039577 |
1096039581 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
12:48501466-48501488
|
12:48501481-48501503
|
Sequence |
CCAGCTTCGGCTCAGCATGAGAG |
CATGAGAGGGAGACCGTGGAAGG |
Strand |
- |
+ |
Off-target summary |
{0: 23, 1: 234, 2: 553, 3: 530, 4: 347} |
{0: 3, 1: 90, 2: 20, 3: 55, 4: 458} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|