ID: 1096039577_1096039581

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1096039577 1096039581
Species Human (GRCh38) Human (GRCh38)
Location 12:48501466-48501488 12:48501481-48501503
Sequence CCAGCTTCGGCTCAGCATGAGAG CATGAGAGGGAGACCGTGGAAGG
Strand - +
Off-target summary {0: 23, 1: 234, 2: 553, 3: 530, 4: 347} {0: 3, 1: 90, 2: 20, 3: 55, 4: 458}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!