ID: 1096085201_1096085208

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1096085201 1096085208
Species Human (GRCh38) Human (GRCh38)
Location 12:48861079-48861101 12:48861120-48861142
Sequence CCAATGAGCAAAACGCGGGTGCT TTCTGTCCTCCACTGAGGGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 18} {0: 1, 1: 0, 2: 2, 3: 14, 4: 200}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!