ID: 1096102594_1096102599

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1096102594 1096102599
Species Human (GRCh38) Human (GRCh38)
Location 12:48978717-48978739 12:48978730-48978752
Sequence CCCGCAGCCCTGGCTGCCAACAG CTGCCAACAGCAGTGGCCGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 51, 4: 407} {0: 1, 1: 0, 2: 2, 3: 18, 4: 274}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!