ID: 1096148825_1096148840

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1096148825 1096148840
Species Human (GRCh38) Human (GRCh38)
Location 12:49296271-49296293 12:49296301-49296323
Sequence CCCACCGCTACCCCCGATCTCAG AGGTGGCATCGGTGGGCGCGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 79} {0: 1, 1: 0, 2: 1, 3: 5, 4: 108}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!