|
Left Crispr |
Right Crispr |
| Crispr ID |
1096167577 |
1096167590 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
12:49437066-49437088
|
12:49437111-49437133
|
| Sequence |
CCCAGACGGAGTGGCTGCCGGGC |
ACGGTGTGGCTGCCGGGTGGAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 19, 1: 404, 2: 2824, 3: 3670, 4: 3662} |
{0: 1, 1: 51, 2: 395, 3: 1052, 4: 2774} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|