ID: 1096173055_1096173059

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1096173055 1096173059
Species Human (GRCh38) Human (GRCh38)
Location 12:49489448-49489470 12:49489497-49489519
Sequence CCTGTCATCTTTTCCAGATAAAT GAGCAACAATGAAATTATCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 60, 4: 579} {0: 1, 1: 0, 2: 2, 3: 5, 4: 185}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!