ID: 1096216711_1096216714

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1096216711 1096216714
Species Human (GRCh38) Human (GRCh38)
Location 12:49801748-49801770 12:49801762-49801784
Sequence CCTGCTTCCCTAGGGGCACGTGA GGCACGTGAGAAGACAGTGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 86} {0: 1, 1: 0, 2: 1, 3: 20, 4: 196}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!