ID: 1096241330_1096241352

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1096241330 1096241352
Species Human (GRCh38) Human (GRCh38)
Location 12:49961800-49961822 12:49961841-49961863
Sequence CCTGCCCCCCCGCGCCGGCCCCG CTATATAGCGCGCCCCAGCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 17, 3: 285, 4: 1776} {0: 1, 1: 0, 2: 0, 3: 2, 4: 7}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!