ID: 1096288711_1096288713

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1096288711 1096288713
Species Human (GRCh38) Human (GRCh38)
Location 12:50322937-50322959 12:50322971-50322993
Sequence CCATCTTCTGTAGATAACTACTT GACAGCTCTTGGCCTGCTACTGG
Strand - +
Off-target summary {0: 1, 1: 18, 2: 218, 3: 209, 4: 313} {0: 9, 1: 184, 2: 221, 3: 158, 4: 208}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!