ID: 1096293023_1096293028

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1096293023 1096293028
Species Human (GRCh38) Human (GRCh38)
Location 12:50358498-50358520 12:50358537-50358559
Sequence CCTTGAGCCCAGGAATTCCAGGC TGTACCAATGCACCCCAGCTTGG
Strand - +
Off-target summary {0: 6, 1: 98, 2: 850, 3: 3312, 4: 6299} {0: 1, 1: 2, 2: 292, 3: 7898, 4: 82616}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!