ID: 1096293026_1096293028

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1096293026 1096293028
Species Human (GRCh38) Human (GRCh38)
Location 12:50358506-50358528 12:50358537-50358559
Sequence CCAGGAATTCCAGGCGGCAGTGT TGTACCAATGCACCCCAGCTTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 78, 3: 1296, 4: 9726} {0: 1, 1: 2, 2: 292, 3: 7898, 4: 82616}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!