ID: 1096309705_1096309706

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1096309705 1096309706
Species Human (GRCh38) Human (GRCh38)
Location 12:50509840-50509862 12:50509863-50509885
Sequence CCTTTATCAAAGTTCTGTCTAAG CAGTTGTAACATCTGATGCTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 156} {0: 1, 1: 0, 2: 1, 3: 12, 4: 152}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!