ID: 1096340021_1096340024

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1096340021 1096340024
Species Human (GRCh38) Human (GRCh38)
Location 12:50789997-50790019 12:50790021-50790043
Sequence CCTGCATTAAATCACATGGATTG CAGAAACCTTTGAGGAATGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 111} {0: 1, 1: 1, 2: 5, 3: 36, 4: 413}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!