ID: 1096340686_1096340694

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1096340686 1096340694
Species Human (GRCh38) Human (GRCh38)
Location 12:50796244-50796266 12:50796287-50796309
Sequence CCTTAGCTGGACATAGTGGCGCA TAGAGGCTAAGGCGGGAAGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 98, 4: 766} {0: 1, 1: 1, 2: 16, 3: 246, 4: 2567}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!