ID: 1096357550_1096357555

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1096357550 1096357555
Species Human (GRCh38) Human (GRCh38)
Location 12:50954247-50954269 12:50954270-50954292
Sequence CCTAATACATGGTAAGCCCCCAG TAAATGTTAGCTGTTATTTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 180} {0: 1, 1: 0, 2: 6, 3: 52, 4: 416}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!