ID: 1096389270_1096389291

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1096389270 1096389291
Species Human (GRCh38) Human (GRCh38)
Location 12:51217075-51217097 12:51217123-51217145
Sequence CCCACCCTTCCAGCAACGCCTGG CGTCCCGGAGTTTGTTCATTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 196} {0: 1, 1: 0, 2: 0, 3: 1, 4: 45}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!