ID: 1096396397_1096396407

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1096396397 1096396407
Species Human (GRCh38) Human (GRCh38)
Location 12:51269863-51269885 12:51269903-51269925
Sequence CCTCCGGGCCTGCTTTCGCCGTC ACAGCCTGCCAAGCCTCACTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 49} {0: 1, 1: 0, 2: 0, 3: 12, 4: 160}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!