ID: 1096404033_1096404037

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1096404033 1096404037
Species Human (GRCh38) Human (GRCh38)
Location 12:51329796-51329818 12:51329818-51329840
Sequence CCATTCACCAAGCAATGGAGGGG GGCCCCCAGAGTCACCCTGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 123} {0: 1, 1: 2, 2: 10, 3: 36, 4: 250}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!