ID: 1096417371_1096417379

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1096417371 1096417379
Species Human (GRCh38) Human (GRCh38)
Location 12:51425349-51425371 12:51425380-51425402
Sequence CCGGCGTCTGGCCTCGCGTTGTC ACGTGGGCAGAAAGGGTAGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 37} {0: 1, 1: 0, 2: 0, 3: 25, 4: 149}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!