ID: 1096418013_1096418022

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1096418013 1096418022
Species Human (GRCh38) Human (GRCh38)
Location 12:51430483-51430505 12:51430516-51430538
Sequence CCCTCCACCCTCTCCTCACACAT CTTTCCATGTGAGAGAATTGGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 7, 3: 71, 4: 818} {0: 1, 1: 0, 2: 2, 3: 44, 4: 456}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!