ID: 1096456310_1096456313

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1096456310 1096456313
Species Human (GRCh38) Human (GRCh38)
Location 12:51790177-51790199 12:51790203-51790225
Sequence CCTTGGGACTGGAAGATCTTAGA CCTGAGCTAAAAACAAAGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 187} {0: 1, 1: 0, 2: 1, 3: 26, 4: 239}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!