ID: 1096457465_1096457471

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1096457465 1096457471
Species Human (GRCh38) Human (GRCh38)
Location 12:51799426-51799448 12:51799460-51799482
Sequence CCAGTAACAGGCCAAGAGCCGTC GAGTAGTTATCTGCAGAAGATGG
Strand - +
Off-target summary {0: 4, 1: 163, 2: 192, 3: 136, 4: 163} {0: 178, 1: 192, 2: 102, 3: 110, 4: 247}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!