ID: 1096488015_1096488030

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1096488015 1096488030
Species Human (GRCh38) Human (GRCh38)
Location 12:51996646-51996668 12:51996691-51996713
Sequence CCTTCTGCCCTTACCCCACACAC GGAAGATGGAGCAGGTCTTTGGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 7, 3: 74, 4: 590} {0: 1, 1: 0, 2: 0, 3: 17, 4: 247}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!