ID: 1096490540_1096490544

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1096490540 1096490544
Species Human (GRCh38) Human (GRCh38)
Location 12:52010402-52010424 12:52010415-52010437
Sequence CCCCCACATCTGGTGGGCTGGCC TGGGCTGGCCCCAGCATAGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 150} {0: 1, 1: 0, 2: 0, 3: 13, 4: 202}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!