ID: 1096518251_1096518265

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1096518251 1096518265
Species Human (GRCh38) Human (GRCh38)
Location 12:52170235-52170257 12:52170264-52170286
Sequence CCTTCTTCCTGGCCTGCTGGAGG GAGTGGGCATGGAGGGAGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 63, 4: 505} {0: 2, 1: 0, 2: 14, 3: 203, 4: 1975}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!