ID: 1096528423_1096528428

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1096528423 1096528428
Species Human (GRCh38) Human (GRCh38)
Location 12:52228139-52228161 12:52228181-52228203
Sequence CCCTCCTCCTTCTTCTTCTCCTT TTCTTTATATTTTGAAGAGATGG
Strand - +
Off-target summary {0: 3, 1: 22, 2: 241, 3: 1400, 4: 5509} {0: 1, 1: 2, 2: 136, 3: 2765, 4: 29324}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!