|
Left Crispr |
Right Crispr |
Crispr ID |
1096528423 |
1096528428 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
12:52228139-52228161
|
12:52228181-52228203
|
Sequence |
CCCTCCTCCTTCTTCTTCTCCTT |
TTCTTTATATTTTGAAGAGATGG |
Strand |
- |
+ |
Off-target summary |
{0: 3, 1: 22, 2: 241, 3: 1400, 4: 5509} |
{0: 1, 1: 2, 2: 136, 3: 2765, 4: 29324} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|