ID: 1096551473_1096551478

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1096551473 1096551478
Species Human (GRCh38) Human (GRCh38)
Location 12:52376333-52376355 12:52376374-52376396
Sequence CCTTCACACCTCTGCTGGGACAT TTTAATGTTGCCCCAAGTCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 25, 4: 232} {0: 1, 1: 0, 2: 1, 3: 13, 4: 128}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!