ID: 1096551545_1096551552

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1096551545 1096551552
Species Human (GRCh38) Human (GRCh38)
Location 12:52376882-52376904 12:52376897-52376919
Sequence CCTATAATGAACTGATGAACTGG TGAACTGGGGGAACTGAGGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 119} {0: 1, 1: 0, 2: 0, 3: 31, 4: 366}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!