ID: 1096565040_1096565052

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1096565040 1096565052
Species Human (GRCh38) Human (GRCh38)
Location 12:52471350-52471372 12:52471388-52471410
Sequence CCCAACCCTATACATCTTCTCCC CAGAGTAAACAGAAGGATGGTGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 1, 3: 10, 4: 202} {0: 3, 1: 0, 2: 2, 3: 48, 4: 401}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!