ID: 1096567297_1096567309

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1096567297 1096567309
Species Human (GRCh38) Human (GRCh38)
Location 12:52492562-52492584 12:52492606-52492628
Sequence CCCTCCTAGGTCTCCCTGGCAGG GGGGACCCTGAAGTGCCCCATGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 28, 4: 244} {0: 1, 1: 2, 2: 1, 3: 15, 4: 234}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!