ID: 1096585689_1096585691

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1096585689 1096585691
Species Human (GRCh38) Human (GRCh38)
Location 12:52618220-52618242 12:52618234-52618256
Sequence CCGGGCGGGCACAACGACGGACA CGACGGACACACGGACCCCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 22} {0: 1, 1: 0, 2: 1, 3: 4, 4: 54}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!