ID: 1096656617_1096656628

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1096656617 1096656628
Species Human (GRCh38) Human (GRCh38)
Location 12:53096557-53096579 12:53096580-53096602
Sequence CCTGGGATGGGCGGGACACTGCC TGGGGAAGGCGGGTGGGGAGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 178} {0: 1, 1: 1, 2: 31, 3: 212, 4: 2044}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!