ID: 1096706625_1096706630

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1096706625 1096706630
Species Human (GRCh38) Human (GRCh38)
Location 12:53425915-53425937 12:53425956-53425978
Sequence CCAAGGTGAGCACCAAGGAGTGT CTGTGTGTATGTATAGAGGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 5, 4: 130} {0: 1, 1: 1, 2: 2, 3: 76, 4: 643}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!