ID: 1096709524_1096709531

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1096709524 1096709531
Species Human (GRCh38) Human (GRCh38)
Location 12:53444982-53445004 12:53445023-53445045
Sequence CCTCCATTTACATTTAACTGCCC GGATTCTAATTCCTGATTCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 141} {0: 1, 1: 0, 2: 1, 3: 19, 4: 206}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!