ID: 1096717090_1096717097

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1096717090 1096717097
Species Human (GRCh38) Human (GRCh38)
Location 12:53498191-53498213 12:53498216-53498238
Sequence CCTAAAGCTCAGAGAAACTTCAG TCTGGACAGGAAGGCTCAGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 30, 4: 293} {0: 1, 1: 0, 2: 5, 3: 32, 4: 299}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!