ID: 1096717353_1096717373

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1096717353 1096717373
Species Human (GRCh38) Human (GRCh38)
Location 12:53499491-53499513 12:53499533-53499555
Sequence CCCGCCTCCTCCTCCTTCTCCTC GCTGCCCTCCACCGGACCCGGGG
Strand - +
Off-target summary {0: 1, 1: 40, 2: 540, 3: 2070, 4: 6332} {0: 1, 1: 0, 2: 0, 3: 16, 4: 108}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!