ID: 1096721888_1096721890

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1096721888 1096721890
Species Human (GRCh38) Human (GRCh38)
Location 12:53529181-53529203 12:53529201-53529223
Sequence CCCTGTCTCTAATATTATTTATT ATTTAGTTATTTATTTAAGACGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 10, 3: 137, 4: 1511} {0: 1, 1: 110, 2: 1437, 3: 2532, 4: 4323}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!