ID: 1096773994_1096774002

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1096773994 1096774002
Species Human (GRCh38) Human (GRCh38)
Location 12:53953176-53953198 12:53953200-53953222
Sequence CCGAGCTGCGAGCTTCGAACTGC CCGGGCAGGGCGGCGCCCGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 1, 4: 40} {0: 1, 1: 0, 2: 1, 3: 36, 4: 517}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!