ID: 1096785586_1096785590

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1096785586 1096785590
Species Human (GRCh38) Human (GRCh38)
Location 12:54015499-54015521 12:54015532-54015554
Sequence CCTGTTATAAAATTTATGGGTGG AGAAACGAGGTCCCTGCATCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 152} {0: 1, 1: 1, 2: 0, 3: 6, 4: 92}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!