ID: 1096791390_1096791403

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1096791390 1096791403
Species Human (GRCh38) Human (GRCh38)
Location 12:54047344-54047366 12:54047393-54047415
Sequence CCCGCGCCGCGGGGCCGCTGCAG GACCATTTCGTTGGAATGTAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 39, 4: 287} {0: 1, 1: 0, 2: 1, 3: 4, 4: 54}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!