ID: 1096829081_1096829093

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1096829081 1096829093
Species Human (GRCh38) Human (GRCh38)
Location 12:54300716-54300738 12:54300740-54300762
Sequence CCCCCTCACCTCCTTCACCCCCC GCCTGCCCCTCGGATCTCACTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 20, 3: 228, 4: 1808} {0: 1, 1: 0, 2: 2, 3: 13, 4: 120}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!