ID: 1096845270_1096845281

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1096845270 1096845281
Species Human (GRCh38) Human (GRCh38)
Location 12:54403164-54403186 12:54403202-54403224
Sequence CCTTCTCCCTGCCCTGTCCTCAC GCTCTTGCTCTGATAATGTAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 19, 3: 179, 4: 1657} {0: 1, 1: 0, 2: 0, 3: 5, 4: 104}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!